We use cookies

Essential storage keeps the site working (sign-in, theme, this choice). We'd also like to load Google Analytics to understand, in aggregate, how the site is used — never your genetic data. See our Cookie Policy.

NEK7 rs576220966: What Your Genotype Means

rs576220966
Trait
Limited evidenceGene: NEK7

The genetic variant rs576220966 is a rare alteration located within the NEK7 gene. Research has identified a statistical association between this specific variant and variations in serum alkaline phosphatase levels.

What each genotype means

T/TLower attention

Typical alkaline phosphatase levels

This is the most common genotype observed in the general population for this location. It is not associated with the specific increase in serum alkaline phosphatase levels linked to the alternative allele. This result does not provide information about your overall health or clinical status.

This is the major allele genotype and is found in the vast majority of the population across all ancestries.

T/TGTTGTTTCCCTCTATGTGTCCModerate attention

Associated with alkaline phosphatase

Research has associated this specific genetic variation with a small, measurable increase in serum alkaline phosphatase levels. Because this association is based on statistical population studies, it does not indicate a medical condition or specific health outcome for you. Please consult with your healthcare provider if you have questions about your laboratory test results.

This genotype is rare and is carried by a very small fraction of the population.

TGTTGTTTCCCTCTATGTGTCC/TGTTGTTTCCCTCTATGTGTCCModerate attention

Associated with alkaline phosphatase

Carrying two copies of this variant is associated with a small increase in serum alkaline phosphatase levels in population-based studies. This finding is a statistical association and is not a diagnostic indicator of any disease or health condition. You should discuss any concerns regarding your blood chemistry results with your physician.

This homozygous genotype is extremely rare in the general population.

Understanding the Variant

The variant rs576220966 is a specific change in the DNA sequence located on chromosome 1 within the NEK7 gene. In genomics, a single-nucleotide polymorphism or variant like this represents a position where the DNA code differs between individuals. This particular variant is categorized as rare, meaning it is not frequently found in the general population. It is identified by its rsID, a unique reference number assigned by the dbSNP database to help researchers track specific locations in the human genome. Because it is located within the NEK7 gene, scientists investigate whether this change might influence how the gene functions or how it is regulated within the body.

The Role of the NEK7 Gene

The NEK7 gene encodes a protein known as NIMA-related kinase 7. This protein is a serine/threonine kinase, which is a type of enzyme that plays a critical role in cell division. Specifically, NEK7 is essential for mitotic progression, helping to organize the structures necessary for cells to divide correctly, such as centrosomal microtubule nucleation and spindle formation. Beyond its role in cell division, NEK7 has been implicated in various biological pathways, including inflammatory responses. Because of its fundamental role in cellular health, researchers often study how variations in this gene might contribute to different physical traits or health conditions across diverse populations.

Research and Associations

The association between rs576220966 and serum alkaline phosphatase levels was identified through genome-wide association studies (GWAS). These studies look for correlations between specific genetic markers and measurable traits across large groups of people. According to data from the GWAS Catalog, this variant has shown a statistically significant association with an increase in serum alkaline phosphatase levels. It is important to note that the evidence for this association is currently considered limited. Statistical associations in GWAS do not necessarily imply a direct cause-and-effect relationship, and they often reflect complex interactions between genetics and environmental factors. Further research is required to fully understand the biological mechanism, if any, that links this specific genetic variant to alkaline phosphatase levels.

What This Information Means for You

If you have encountered this variant in your genetic data, it is helpful to understand that this information is primarily for educational purposes. Genetic associations are statistical observations made at the population level and cannot predict individual health outcomes. Because the evidence for this specific association is limited, it should not be used to make medical decisions or to assess personal health risks. If you have concerns about your alkaline phosphatase levels or any other health markers, the most appropriate step is to consult with a qualified healthcare professional. They can interpret your clinical laboratory results in the context of your overall health history and provide guidance that is tailored to your specific needs.

How common is this variant?

The variant rs576220966 is classified as rare in the general population, meaning it is found in a very small percentage of individuals across most ancestral groups.

Frequently asked questions

What is a GWAS study?

A Genome-Wide Association Study (GWAS) is a research approach used to identify links between genetic variants and specific traits or diseases. By comparing the DNA of many people, researchers can find markers that appear more frequently in individuals with a certain trait.

Does having this variant mean I have a health condition?

No. Genetic associations are statistical findings and do not constitute a medical diagnosis. Many factors, including lifestyle and environment, influence health markers like alkaline phosphatase.

What is alkaline phosphatase?

Alkaline phosphatase is an enzyme found throughout the body, with high concentrations in the liver and bones. Doctors often measure its levels in the blood as part of routine health screenings to monitor liver or bone health.

Should I be worried about this variant?

There is no reason for concern based on this variant alone. Because the evidence linking it to alkaline phosphatase is limited, it is not considered a standard clinical marker for health assessment.

Sources & further reading

Educational information only, last refreshed 10/3/2026. Not medical advice — these associations describe population statistics, not individual predictions.

Curious what your genotype is for rs576220966?

Upload a raw DNA file from 23andMe, AncestryDNA, MyHeritage, or FamilyTreeDNA and see this variant — plus thousands more — interpreted in your full report.

Get my report — $29

Related variants in NEK7