We use cookies

Essential storage keeps the site working (sign-in, theme, this choice). We'd also like to load Google Analytics to understand, in aggregate, how the site is used — never your genetic data. See our Cookie Policy.

CPT1A rs80356802: Understanding Metabolic Variant Associations

rs80356802
Trait
Moderate evidenceGene: CPT1A

The rs80356802 variant is a genetic change located within the CPT1A gene, which plays a critical role in how the body processes fats. It is primarily studied in the context of rare, inherited metabolic conditions that affect the body's ability to manage energy during periods of fasting.

What each genotype means

-/GTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAGLower attention

Carrier of insertion variant

You carry one copy of this insertion variant. Current research does not indicate that being a carrier of this specific structural change results in clinical CPT1A deficiency, which typically requires two pathogenic variants.

This genotype is rare and observed infrequently in general population databases.

GTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG/GTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAGModerate attention

Homozygous for insertion variant

You carry two copies of this insertion variant. While this variant is cataloged in research databases, its specific clinical significance regarding metabolic stress or fatty acid oxidation remains limited; you should discuss any concerns about metabolic health or fasting tolerance with a healthcare provider.

This genotype is extremely rare in the general population.

What is rs80356802?

The variant rs80356802 is a specific change in the DNA sequence of the CPT1A gene, which is located on chromosome 11. In genetics, a variant like this represents a difference in the building blocks of DNA compared to the most common sequence found in the general population. This particular variant is cataloged in major genetic databases, including ClinVar and dbSNP, where it has been identified as a point of interest for researchers studying metabolic health. Because it sits within the CPT1A gene, scientists investigate whether this change alters the structure or function of the protein that the gene produces. Understanding the location and nature of this variant is the first step in determining how it might influence biological processes, particularly those related to how our cells generate energy from the fats we consume.

The Role of the CPT1A Gene

The CPT1A gene provides instructions for making an enzyme called carnitine palmitoyltransferase 1A. This enzyme is essential for the mitochondrial oxidation of long-chain fatty acids, which are a primary source of energy for the body, especially for the liver and kidneys. By acting as a gatekeeper, this enzyme helps transport fatty acids into the mitochondria, the powerhouses of the cell, where they can be broken down to produce energy. When the body is in a fasting state, it relies heavily on these stored fats to maintain blood sugar levels and provide fuel. If the CPT1A enzyme is not functioning correctly, the body may struggle to convert these fats into energy, which can lead to metabolic stress. This process is vital for maintaining homeostasis during periods when dietary intake is limited.

Research and Clinical Associations

Research into CPT1A variants often focuses on their link to carnitine palmitoyltransferase 1A deficiency, a rare autosomal recessive metabolic disorder. Individuals with this condition may experience symptoms such as hypoketotic hypoglycemia, where the body fails to produce enough ketones during fasting, leading to dangerously low blood sugar. While some variants in CPT1A are well-documented as pathogenic, the evidence strength for specific variants like rs80356802 is often categorized as moderate or requires further clinical validation. It is important to note that the presence of a variant does not automatically result in a clinical diagnosis. Many genetic factors contribute to metabolic health, and the severity of any associated condition can vary significantly between individuals. Current research continues to map how these specific genetic changes correlate with clinical outcomes in diverse populations.

Population Frequency

The rs80356802 variant is considered rare in the general global population. Genetic databases like gnomAD indicate that such variants are not widely distributed across all ancestral groups, often appearing at very low frequencies. In some cases, specific variants in the CPT1A gene have been identified as founder mutations, meaning they are more common in certain isolated or specific ethnic populations due to historical demographic factors. However, for rs80356802, the frequency remains low, which is consistent with its classification as a rare genetic marker. Because it is rare, large-scale population studies are necessary to fully understand its distribution and potential impact across different ancestries.

Interpreting Your Genetic Information

If you have encountered this variant in a personal genetic report, it is essential to understand that this information is for educational purposes only. Genetic variants are complex, and their presence does not constitute a medical diagnosis or a prediction of future health. Many factors, including environment, diet, and other genetic modifiers, influence how our bodies function. You should never use genetic data to make decisions about your health, such as changing your diet or stopping medications, without consulting a qualified healthcare professional. If you have concerns about your metabolic health or family history, a genetic counselor or a metabolic specialist can provide context and guidance based on your specific clinical situation. They are the best resources for interpreting how your unique genetic profile relates to your overall well-being.

How common is this variant?

The rs80356802 variant is rare in the general population, with its frequency varying significantly depending on ancestral background.

Frequently asked questions

What is CPT1A deficiency?

CPT1A deficiency is a rare, inherited metabolic disorder that prevents the body from using certain fats for energy. It typically manifests during periods of fasting and can lead to low blood sugar.

Does having a CPT1A variant mean I have a disease?

No, having a genetic variant does not mean you have a disease. Many variants are benign, and even those associated with conditions often require specific environmental triggers or the inheritance of two copies of a variant.

How can I find out if I have this variant?

This variant is typically identified through clinical genetic testing ordered by a physician. Direct-to-consumer tests may not always include rare variants or provide the clinical context needed for interpretation.

What should I do if I am concerned about my metabolic health?

If you have concerns, you should speak with your primary care physician or a genetic counselor. They can evaluate your symptoms, family history, and clinical needs to determine if further testing is appropriate.

Sources & further reading

Educational information only, last refreshed 9/25/2026. Not medical advice — these associations describe population statistics, not individual predictions.

Curious what your genotype is for rs80356802?

Upload a raw DNA file from 23andMe, AncestryDNA, MyHeritage, or FamilyTreeDNA and see this variant — plus thousands more — interpreted in your full report.

Get my report — $29

Related variants in CPT1A